Review



478293_mir  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Thermo Fisher 478293_mir
    478293 Mir, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/478293_mir/478293_mir/pmc13036163-197-9-11
    Average 95 stars, based on 1 article reviews
    478293_mir - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Salivary and urinary microRNAs as non-invasive biomarkers of minimal residual disease in pediatric acute lymphoblastic leukemia.
    Article Snippet: .. TaqManTM Advanced miRNA Assays utilized in this study miRNA Mature miRNA sequence ID Catalog # hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA 477994_mir A25576 hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 477860_mir A25576 hsa-miR-1246 AAUGGAUUUUUGGAGCAGG 483023_mir A25576 hsa-miR-223-3p UGUCAGUUUGUCAAAUACCCCA 477983_mir A25576 hsa-miR-1290 UGGAUUUUUGGAUCAGGGA 477895_mir A25576 cel-miR-39-3p UCACCGGGUGUAAAUCAGCUUG 478293_mir A25576 Table S2. ..

    Control:

    Article Title: Extracellular Vesicle-Derived MicroRNAs’ Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-39-3p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 10 8 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    Article Title: Leukocyte telomere length and circulating MiRNAs in relation to cardiovascular outcomes in older adults
    Article Snippet: .. Subsequently, 25 fmol of synthetic cel-miR-39-3p (Thermo Fisher Scientific, Assay ID: 478293_mir) was added as a spike-in control. ..

    Article Title: Extracellular Vesicle-Derived MicroRNAs' Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis.
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-393p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 108 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    RNA Extraction:

    Article Title: Extracellular Vesicle-Derived MicroRNAs’ Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-39-3p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 10 8 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    Article Title: Extracellular Vesicle-Derived MicroRNAs' Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis.
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-393p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 108 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    Isolation:

    Article Title: Extracellular Vesicle-Derived MicroRNAs’ Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-39-3p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 10 8 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    Article Title: Extracellular Vesicle-Derived MicroRNAs' Value in Diagnosing and Predicting Clinical Outcomes in Patients with COVID-19 and Bacterial Sepsis.
    Article Snippet: .. The synthetic cel-miR-39-3p (478293_mir) (Applied Biosystems, ThermoFisher Scientific) was used as an exogenous control to monitor RNA extraction efficiency. miRNAs were isolated from 150 μL of EV pellet using miRNeasy Mini Kit (Qiagen, Crawley, UK) following the manufacturer’s instructions. .. Spike-in control Cel-miR-393p (Applied Biosystems, ThermoFisher Scientific) from Caenorhabditis elegans solution (1.6 × 108 copies/μL) was added as an exogenous control to assess RNA extraction efficiency.

    other:

    Article Title: In Situ Expression of miR-371a-3p and miR-373-3p in Testicular Germ Cell Tumours and Detection in Serum.
    Article Snippet: Pre-amplified cDNA was diluted 1:8 in 0.1 × Tris-EDTA buffer and quantified in duplicates using the same TaqMan Fast Advanced MasterMix, No UNG (Cat no A44360, Thermo Fisher Scientific) and TaqMan MicroRNA Assays (20 ×) as used in the pre-amplification reaction in a QuantStudio 5 PCR instrument (Thermo Fisher Scientific).

    Article Title: Plasma miR-134-5p: a candidate biomarker for predicting non-response to anti-TNF therapy in rheumatoid arthritis
    Article Snippet: 10 pM of cel-miR-39-3p spike-in or exogenous control (Assay 478293_mir, #10620310, Thermo Fisher Scientific, Waltham, MA, USA) was added to each sample to monitor extraction efficiency.

    Article Title: Discovery of new MicroRNAs and their mRNA targets in patients with acute ischemic stroke
    Article Snippet: (i) Consumables: S-Monovette Citrate #05.1165 blood collection tubes; EppendorfTM DNA LoBindTM Tubes #13-698-791; (ii) RNA extraction kits: mirVanaTM miRNA Isolation Kit, with phenol #AM1560, Invitrogen; Cel-miR-39-3p mimic: MC10956, catalog #4,464,066; (iii) small RNA quality control with Bioanalyzer: Agilent, High Sensitivity RNA ScreenTape Sample Buffer #5067–5580; Agilent, High Sensitivity RNA ScreenTape # 5067–5579; Agilent, High Sensitivity RNA ScreenTape Ladder #5067–5581; Agilent Small RNA kit #5067 − 1548 (iv) The GeneChipTM Human Transcriptome Array 2.0, #902,162; FlashTagTM Biotin HSR RNA Labeling Kits, Applied BiosystemsTM, #901,910; GeneChipTM miRNA 4.0 Array, Applied BiosystemsTM #902,411. (v) cDNA synthesis: TaqManTM Advanced miRNA cDNA Synthesis Kit # A28007 . (vi) RT-qPCR primers: 478551_mir, miR-18a-5p; 478902_mir, miR-4467; 478231_mir, miR-199a-5p; 478011_mir, miR-3135b; 478640_mir, miR-1226; 478018_mir, miR-3185; 478293_mir, Cel-miR-39-3p; Hs01074529_m1, ANKRD12; Hs00153153_m1, HIF1A, Hs01064686_m1, GNAI2; Hs00609557_m1; GRIN1; Hs05003736_s1, AGO1; Hs02786624_g1, GAPDH - Applied Biosystems; (vii) PCR reaction: TaqManTM Fast Advanced Master Mix for qPCR #4,444,558.



    Similar Products

    Image Search Results